ID: 1078560198_1078560208

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1078560198 1078560208
Species Human (GRCh38) Human (GRCh38)
Location 11:12364533-12364555 11:12364577-12364599
Sequence CCATGTTCCCTCTGAGACTCTAG CTCCACCTTCTGGAAGTCCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 18, 3: 56, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!