ID: 1078561700_1078561721

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1078561700 1078561721
Species Human (GRCh38) Human (GRCh38)
Location 11:12377996-12378018 11:12378047-12378069
Sequence CCGCCCGCTCGCGGTCGCCCGGG CAACGCCCCCGCCGGGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 125} {0: 1, 1: 0, 2: 0, 3: 7, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!