ID: 1078562714_1078562715

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1078562714 1078562715
Species Human (GRCh38) Human (GRCh38)
Location 11:12387315-12387337 11:12387328-12387350
Sequence CCTTTCTTTTCTGTTTTTTCTGC TTTTTTCTGCAGATGCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 272, 4: 3263} {0: 1, 1: 0, 2: 3, 3: 28, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!