ID: 1078569439_1078569441

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1078569439 1078569441
Species Human (GRCh38) Human (GRCh38)
Location 11:12444778-12444800 11:12444791-12444813
Sequence CCAGAGGCATGCTGAGACCTCAG GAGACCTCAGCGTTGGCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 240} {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!