ID: 1078570662_1078570669

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1078570662 1078570669
Species Human (GRCh38) Human (GRCh38)
Location 11:12455114-12455136 11:12455150-12455172
Sequence CCCAAAAACTGATGGGTAGATAT GTGTGTCTCTTCAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213} {0: 1, 1: 0, 2: 3, 3: 180, 4: 4622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!