ID: 1078594291_1078594300

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1078594291 1078594300
Species Human (GRCh38) Human (GRCh38)
Location 11:12673979-12674001 11:12674001-12674023
Sequence CCCGCGCTTCCGCGTCCCGGACT TAGGGAAACTGAGGCACGGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 25, 3: 178, 4: 792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!