ID: 1078601470_1078601475

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1078601470 1078601475
Species Human (GRCh38) Human (GRCh38)
Location 11:12735285-12735307 11:12735315-12735337
Sequence CCTTTTTGGTTCATTCACTCTGA CTGAATAAGCATTAGGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 255} {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!