ID: 1078606918_1078606931

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1078606918 1078606931
Species Human (GRCh38) Human (GRCh38)
Location 11:12785138-12785160 11:12785186-12785208
Sequence CCTGTGCCTGGGAGCCGTGGGGA GTAAGTGGGGGTAGGAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 275} {0: 1, 1: 0, 2: 0, 3: 68, 4: 714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!