ID: 1078638986_1078638993

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1078638986 1078638993
Species Human (GRCh38) Human (GRCh38)
Location 11:13077921-13077943 11:13077943-13077965
Sequence CCTTTCCCAAAATGACTATGGCA ATATAAGGAGGCCTGGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!