ID: 1078659740_1078659755

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1078659740 1078659755
Species Human (GRCh38) Human (GRCh38)
Location 11:13277566-13277588 11:13277619-13277641
Sequence CCACACAACTGGCCAGCGGGCTG CCGCCGGGACCGGCTCCCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148} {0: 1, 1: 0, 2: 1, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!