ID: 1078660283_1078660286

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1078660283 1078660286
Species Human (GRCh38) Human (GRCh38)
Location 11:13280142-13280164 11:13280178-13280200
Sequence CCAGAATATCTGAGCTGAAGCCC AAGTTAAGCAGATCAACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 189} {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!