ID: 1078668913_1078668922

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1078668913 1078668922
Species Human (GRCh38) Human (GRCh38)
Location 11:13348030-13348052 11:13348074-13348096
Sequence CCTACAAGCAGAGAATGGTCACA GGAGCTGCTGCAGGAGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180} {0: 1, 1: 2, 2: 10, 3: 74, 4: 742}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!