ID: 1078707411_1078707419

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1078707411 1078707419
Species Human (GRCh38) Human (GRCh38)
Location 11:13758543-13758565 11:13758573-13758595
Sequence CCATCTTCCCTCTGATCTAGCTG CTCTATTGGATGGGTTGTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!