ID: 1078749248_1078749255

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1078749248 1078749255
Species Human (GRCh38) Human (GRCh38)
Location 11:14144209-14144231 11:14144238-14144260
Sequence CCTTCCATCTTCTAAAAGGGTAT TTTACTGGGTGGGAATACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197} {0: 1, 1: 0, 2: 2, 3: 19, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!