ID: 1078765415_1078765422

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1078765415 1078765422
Species Human (GRCh38) Human (GRCh38)
Location 11:14292242-14292264 11:14292260-14292282
Sequence CCCTCCTCCCTTCCCTAATCTGC TCTGCCACTGCCTACCCTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 97, 4: 833} {0: 1, 1: 0, 2: 1, 3: 22, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!