ID: 1078766194_1078766197

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1078766194 1078766197
Species Human (GRCh38) Human (GRCh38)
Location 11:14300815-14300837 11:14300851-14300873
Sequence CCTTCCGCCTTCAGTGGTAAGGA TTCTTCTGACACCAAGCTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117} {0: 1, 1: 0, 2: 1, 3: 21, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!