ID: 1078784126_1078784128

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1078784126 1078784128
Species Human (GRCh38) Human (GRCh38)
Location 11:14471292-14471314 11:14471307-14471329
Sequence CCTTCTTGTACCAAACAGTGCAA CAGTGCAAACATTATTAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 130} {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!