ID: 1078815939_1078815946

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1078815939 1078815946
Species Human (GRCh38) Human (GRCh38)
Location 11:14822757-14822779 11:14822771-14822793
Sequence CCCATACAGACCCCTAAGAAGTA TAAGAAGTAGCTGAATTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 212} {0: 1, 1: 0, 2: 1, 3: 22, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!