ID: 1078815939_1078815947

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1078815939 1078815947
Species Human (GRCh38) Human (GRCh38)
Location 11:14822757-14822779 11:14822786-14822808
Sequence CCCATACAGACCCCTAAGAAGTA TTCAGGGGTCTGAGCAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 212} {0: 1, 1: 0, 2: 10, 3: 31, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!