ID: 1078823667_1078823671

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1078823667 1078823671
Species Human (GRCh38) Human (GRCh38)
Location 11:14906642-14906664 11:14906664-14906686
Sequence CCCACAGGATGGGACTAAGTGCC CTTCAACCCCAAGCGGAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97} {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!