ID: 1078832660_1078832665

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1078832660 1078832665
Species Human (GRCh38) Human (GRCh38)
Location 11:14992155-14992177 11:14992189-14992211
Sequence CCAATATGGCAGTGGGTGTACAT TATTGTTTCTAATATACAAGAGG
Strand - +
Off-target summary {0: 1, 1: 24, 2: 160, 3: 549, 4: 1359} {0: 1, 1: 18, 2: 134, 3: 629, 4: 1515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!