|
Left Crispr |
Right Crispr |
| Crispr ID |
1078834663 |
1078834670 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:15015769-15015791
|
11:15015811-15015833
|
| Sequence |
CCAGCAGGATATCATCCAGGAGA |
ACAGGCCAACATTCAAATTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 42, 2: 57, 3: 38, 4: 153} |
{0: 1171, 1: 3836, 2: 3846, 3: 2844, 4: 1009} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|