ID: 1078845143_1078845147

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1078845143 1078845147
Species Human (GRCh38) Human (GRCh38)
Location 11:15113715-15113737 11:15113728-15113750
Sequence CCTTCTGAGCCCTGGGCCCCCAG GGGCCCCCAGAGAGCTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 70, 4: 518} {0: 1, 1: 0, 2: 4, 3: 39, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!