ID: 1078916504_1078916508

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1078916504 1078916508
Species Human (GRCh38) Human (GRCh38)
Location 11:15783644-15783666 11:15783675-15783697
Sequence CCTGATAAGCAGATGACTGTCAG ATTCCGCACCTGAGGGCCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!