ID: 1078930015_1078930022

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1078930015 1078930022
Species Human (GRCh38) Human (GRCh38)
Location 11:15905615-15905637 11:15905633-15905655
Sequence CCAACCTGCCCACAGGCGCTGGC CTGGCCACCGCCTGGGCAGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 31, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!