|
Left Crispr |
Right Crispr |
| Crispr ID |
1078945819 |
1078945823 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:16067571-16067593
|
11:16067588-16067610
|
| Sequence |
CCCAGTCTCTGGTATGTCCTCAT |
CCTCATTAGCAGCATGAGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 30, 2: 698, 3: 5814, 4: 11072} |
{0: 1, 1: 1, 2: 23, 3: 473, 4: 1008} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|