|
Left Crispr |
Right Crispr |
| Crispr ID |
1078949705 |
1078949708 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:16116719-16116741
|
11:16116735-16116757
|
| Sequence |
CCAGGTTGTGGCCTGTTAGGAAC |
TAGGAACTGGACCACATAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 26, 2: 248, 3: 448, 4: 683} |
{0: 1, 1: 31, 2: 288, 3: 603, 4: 1103} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|