ID: 1078952325_1078952327

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1078952325 1078952327
Species Human (GRCh38) Human (GRCh38)
Location 11:16148221-16148243 11:16148238-16148260
Sequence CCATAGCCTTTTTTTATTCTTCA TCTTCATTGTTTGAATAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 1068} {0: 1, 1: 0, 2: 1, 3: 20, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!