ID: 1078955933_1078955939

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1078955933 1078955939
Species Human (GRCh38) Human (GRCh38)
Location 11:16195064-16195086 11:16195104-16195126
Sequence CCACCAAGTATTGCAGGATTGGC CATGAGCGTTAGGAGAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66} {0: 1, 1: 0, 2: 2, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!