ID: 1078957106_1078957109

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1078957106 1078957109
Species Human (GRCh38) Human (GRCh38)
Location 11:16211400-16211422 11:16211415-16211437
Sequence CCTGGACCAAGGTGATAGCAATG TAGCAATGGCAAATTTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 146} {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!