ID: 1078969007_1078969011

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1078969007 1078969011
Species Human (GRCh38) Human (GRCh38)
Location 11:16384344-16384366 11:16384363-16384385
Sequence CCCTGTTCAAATCACCTCCATGA ATGACATCCTAGAAGAATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 285} {0: 1, 1: 0, 2: 0, 3: 21, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!