ID: 1079007712_1079007716

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1079007712 1079007716
Species Human (GRCh38) Human (GRCh38)
Location 11:16803796-16803818 11:16803814-16803836
Sequence CCGTGGGTAAGGCCAGCCTTCCT TTCCTTACCCTTTACCATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 250} {0: 1, 1: 0, 2: 1, 3: 17, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!