ID: 1079022904_1079022915

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1079022904 1079022915
Species Human (GRCh38) Human (GRCh38)
Location 11:16924053-16924075 11:16924085-16924107
Sequence CCTGGTCCACAGCCCTCCATTTA CCTTCCACTCCCACTCATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157} {0: 1, 1: 0, 2: 2, 3: 14, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!