ID: 1079043164_1079043179

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1079043164 1079043179
Species Human (GRCh38) Human (GRCh38)
Location 11:17077557-17077579 11:17077600-17077622
Sequence CCACACTCCCTGTCTTCCTCCCA CTTGATGCCCCGAGCTCACCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 27, 3: 352, 4: 3772} {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!