ID: 1079054489_1079054498

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1079054489 1079054498
Species Human (GRCh38) Human (GRCh38)
Location 11:17194010-17194032 11:17194059-17194081
Sequence CCTAAAGAAGATGCAGGCTTTGG TATGAAGGCCCTTGTAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 211} {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!