|
Left Crispr |
Right Crispr |
| Crispr ID |
1079063198 |
1079063201 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:17267492-17267514
|
11:17267513-17267535
|
| Sequence |
CCGGCTAATTTCTGCATTTAATT |
TTTATTTTTTTGGTAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 14, 3: 737, 4: 8655} |
{0: 32, 1: 1396, 2: 16543, 3: 143081, 4: 311561} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|