ID: 1079080594_1079080602

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079080594 1079080602
Species Human (GRCh38) Human (GRCh38)
Location 11:17411019-17411041 11:17411053-17411075
Sequence CCAGGTTCCCAGGAAGCCTGCCG TCCTGAGCTGTTCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 208} {0: 1, 1: 0, 2: 2, 3: 25, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!