ID: 1079080600_1079080602

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1079080600 1079080602
Species Human (GRCh38) Human (GRCh38)
Location 11:17411039-17411061 11:17411053-17411075
Sequence CCGTCTGGGCCTTCTCCTGAGCT TCCTGAGCTGTTCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 307} {0: 1, 1: 0, 2: 2, 3: 25, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!