ID: 1079086490_1079086492

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1079086490 1079086492
Species Human (GRCh38) Human (GRCh38)
Location 11:17449285-17449307 11:17449306-17449328
Sequence CCAGTGGAGAACACAGATCAGAG AGCCATAAAAATGATGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 214} {0: 1, 1: 0, 2: 5, 3: 43, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!