ID: 1079087259_1079087269

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1079087259 1079087269
Species Human (GRCh38) Human (GRCh38)
Location 11:17455452-17455474 11:17455491-17455513
Sequence CCTTTGACTTCCTCTCTCCGCCC GGGTCAGAAATCTACTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 463} {0: 1, 1: 0, 2: 0, 3: 22, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!