ID: 1079097001_1079097010

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1079097001 1079097010
Species Human (GRCh38) Human (GRCh38)
Location 11:17517460-17517482 11:17517480-17517502
Sequence CCACTCCCTGATCATCTACCCAG CAGGGAAAAGAGGAGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215} {0: 1, 1: 3, 2: 16, 3: 148, 4: 1153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!