ID: 1079106034_1079106040

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1079106034 1079106040
Species Human (GRCh38) Human (GRCh38)
Location 11:17573074-17573096 11:17573094-17573116
Sequence CCAGCCTCCTACTCAGTGCAGGC GGCCTGCAGCGTGCTCACGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 263} {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!