ID: 1079112327_1079112343

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1079112327 1079112343
Species Human (GRCh38) Human (GRCh38)
Location 11:17611963-17611985 11:17612003-17612025
Sequence CCCTGACCCCCGAGCTCACACTA CACATGGCTTGTGGTGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100} {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!