ID: 1079112336_1079112346

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1079112336 1079112346
Species Human (GRCh38) Human (GRCh38)
Location 11:17611995-17612017 11:17612010-17612032
Sequence CCAGGCCCCACATGGCTTGTGGT CTTGTGGTGGGTAGGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192} {0: 1, 1: 0, 2: 5, 3: 121, 4: 1090}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!