ID: 1079112763_1079112777

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1079112763 1079112777
Species Human (GRCh38) Human (GRCh38)
Location 11:17614148-17614170 11:17614184-17614206
Sequence CCCACCCCCATATGGGCATCCTC CCTTTGCTCCTCCCAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152} {0: 1, 1: 0, 2: 5, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!