ID: 1079131398_1079131409

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1079131398 1079131409
Species Human (GRCh38) Human (GRCh38)
Location 11:17748886-17748908 11:17748930-17748952
Sequence CCCAGCAGGAGATGGTGGGTCCC GTGTGGGGCTGGAGAGAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 192} {0: 1, 1: 1, 2: 9, 3: 106, 4: 738}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!