ID: 1079133110_1079133115

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1079133110 1079133115
Species Human (GRCh38) Human (GRCh38)
Location 11:17761033-17761055 11:17761055-17761077
Sequence CCAAGACAGGCAGGGGTCCACGT TGGAAAACCCTGCAAGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 152} {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!