ID: 1079159561_1079159566

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1079159561 1079159566
Species Human (GRCh38) Human (GRCh38)
Location 11:17979260-17979282 11:17979309-17979331
Sequence CCTCGCAAACCTCAAGAAATAGT CACTGCTTGCAGAAATTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 96} {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!