ID: 1079162355_1079162357

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1079162355 1079162357
Species Human (GRCh38) Human (GRCh38)
Location 11:18006858-18006880 11:18006875-18006897
Sequence CCATCCAAGTTAATAAGCTGTGT CTGTGTATGTTCATGTATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119} {0: 1, 1: 0, 2: 1, 3: 11, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!