ID: 1079171882_1079171885

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1079171882 1079171885
Species Human (GRCh38) Human (GRCh38)
Location 11:18104601-18104623 11:18104643-18104665
Sequence CCCTTAGGTGCTGATATTTAAGC AGTAGTTTGTCATGTGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 149} {0: 1, 1: 0, 2: 1, 3: 19, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!